Unveiling novel anti-viral mechanisms of ε-poly-l-lysine on tobacco mosaic virus-infected Nicotiana tabacum through microRNA and transcriptome sequencing.

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.

Bioinformatic Identification of Signaling Pathways and Hub Genes in Vascular Dementia.

BACKGROUND: Vascular dementia (VaD) is a prevalent neurodegenerative disease characterized by cognitive impairment due to cerebrovascular factors, affecting a significant portion of the aging population and highlighting the critical need to understand specific targets and mechanisms for effective prevention and treatment strategies. We aimed to identify pathways and crucial genes involved in the progression of VaD through bioinformatics analysis and subsequently validate these findings. METHODS: We conducted differential expression analysis, Weighted Gene Co-expression Network Analysis (WGCNA), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and Protein-Protein Interaction (PPI) analysis. We utilized pheochromocytoma 12 (PC12) cells to create an in vitro oxygen-glucose deprivation (OGD) model. We investigated the impact of overexpression and interference of adrenoceptor alpha 1D (ADRA1D) on OGD PC12 cells using TdT-mediated dUTP nick-end labeling (TUNEL), reverse transcription-quantitative polymerase chain reaction (RT-qPCR), western blot (WB), and Fluo-3-pentaacetoxymethyl ester (Fluo-3 AM) analysis. RESULTS: We found 187 differentially expressed genes (DEGs) in the red module that were strongly associated with VaD and were primarily enriched in vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction, mitogen-activated protein kinase (MAPK) signaling pathway, and cell adhesion. Among these pathways, we identified ADRA1D as a gene shared by vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction. The TUNEL assay revealed a significant decrease in PC12 cell apoptosis with ADRA1D overexpression (p < 0.01) and a significant increase in apoptosis upon silencing ADRA1D (p < 0.01). RT-qPCR and WB analysis revealed elevated ADRA1D expression (p < 0.001) and decreased phospholipase C beta (PLCß) and inositol 1,4,5-trisphosphate receptor (IP3R) expression (p < 0.05) with ADRA1D overexpression. Moreover, the Fluo-3 AM assessment indicated significantly lower intracellular Ca2+ levels with ADRA1D overexpression (p < 0.001). Conversely, interference with ADRA1D yielded opposite results. CONCLUSION: Our study provides a new perspective on the pathogenic mechanisms of VaD and potential avenues for therapeutic intervention. The results highlight the role of ADRA1D in modulating cellular responses to OGD and VaD, suggesting its potential as a target for VaD treatment.

First Report of Tomato Yellow Mottle-Associated Virus Infecting Tobacco in China.

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

Molecular characterization and pathogenicity of a novel monopartite geminivirus infecting tobacco in China.

The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.

Antibacterial Activities and Underlying Mechanisms of the Compound SYAUP-491 against Xanthomonas oryzae pv. oryzae.

SYAUP-491 is a novel alkyl sulfonamide. In this study, in vivo and in vitro tests were performed along with a proteomic analysis to determine the effects and underlying mechanisms of the antibacterial activity of SYAUP-491 against the causative agent of bacterial leaf blight in rice. The antibacterial test results suggested that SYAUP-491 exhibited significant activities against Xanthomonas oryzae pv. oryzae (Xoo) in vitro and in vivo. The minimal EC50 values reached 6.96 µg/mL and the curative activity reached 74.1%. Detailed studies demonstrated that SYAUP-491 altered membrane permeability and caused morphological changes. Based on proteomics results, SYAUP-491 might inhibit bacterial protein synthesis. SYAUP-491 may disrupt and alter cell membrane permeability and could further act on ribosomes in the bacterial body. Given the above results, SYAUP-491 could serve as a new lead compound in the research of antibacterial control of plant pathogenic bacterial disease.

Formononetin alleviates cerebral ischemia-reperfusion injury in rats by targeting the PARP-1/PARG/Iduna signaling pathway.

Formononetin has been demonstrated to protect against cerebral ischemia-reperfusion injury, however its mechanism has to be further researched. This study examined the effect of formononetin on cerebral ischemia-reperfusion injury in rats using the PARP-1/PARG/Iduna signaling pathway. In male SD rats, a model of cerebral ischemia-reperfusion injury was developed. Animals were randomly assigned to one of eight groups: Sham operation, Sham operation + formononetin, MCAO, MCAO + formononetin, PARP inhibitor (PJ34) + MCAO, formononetin + PJ34 + MCAO, PARG inhibitor (Ethacridine lactate) + MCAO, and ethacridine lactate + formononetin. The neurological deficit test, TTC staining, HE staining, Nissl staining, TUNEL staining, and western blotting were utilized to assess formononetin's protective effects in MCAO rats. The data show that formononetin can effectively alleviate neurological dysfunction and pathological changes in brain tissue in rats with cerebral ischemia-reperfusion injury, reduce the area of cerebral infarction and neuronal apoptosis, decrease the protein levels of PARP-1, PARG, Caspase-3, P53, and AIF in brain tissue, and increase the protein levels of Iduna and p-AKT. As a result, we concluded that formononetin improves brain ischemia-reperfusion injury in rats by modulating the PARP-1/PARG/Iduna signaling pathway.

Antiviral Mechanisms of Anisomycin Produced by Streptomyces albulus SN40 on Potato Virus Y.

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.

Rodenticide poisoning leading to cerebral hemorrhage: A case report.

RATIONALE: Anticoagulant rodenticides (ARs) are a substantial fraction of murine types. AR poisoning causes bleeding from the skin, mucous membranes, and multiple organs. However, reports of AR-induced cerebral hemorrhage are scarce. PATIENT CONCERNS: A 40-year-old male presented with dizziness, headache, and limb weakness for 5 days and with coagulopathy. Two days prior to the onset of these symptoms, the patient was exposed to dead mice. DIAGNOSES: Rodenticide intoxication-induced cerebral hemorrhage. INTERVENTIONS: Vitamin K1 infusion, administration of dehydrating agents to reduce intracranial pressure, and correction of acid-base and electrolyte imbalances. OUTCOMES: After 9 days of treatment, the patient's symptoms were relieved, and reexamination revealed that coagulation parameters returned to normal levels. The patient was eventually discharged for observation with oral vitamin K1. CONCLUSIONS: Rodenticide poisoning can lead to intracerebral hemorrhage, and treatment with vitamin K1 infusion is effective. LESSON: Rodenticide poisoning-induced cerebral hemorrhage is rarely reported. Because its symptoms are nonspecific, it is easy to miss the diagnosis or misdiagnose. When patients present with direct and indirect symptoms such as dizziness, headache, and limb weakness, rodenticide poisoning should be considered. Coagulation function and head computed tomography or magnetic resonance imaging examination should be performed at the earliest to confirm the diagnosis and provide timely treatment.

RNA interference-based exogenous double-stranded RNAs confer resistance to Rhizoctonia solani AG-3 on Nicotiana tabacum.

BACKGROUND: Rhizoctonia solani Kühn is a pathogenic fungus causing tobacco target spot disease, and leads to great losses worldwide. At present, resistant varieties and effective control strategy on tobacco target spot disease are very limited. Host-induced gene silencing (HIGS) as well as the exogenous dsRNA can be used to suppress disease progression, and reveal the function of crucial genes involved in the growth and pathogenesis of the fungus. RESULTS: The silencing of endoPGs or RPMK1 in host plants by TRV-based HIGS resulted in a significant reduction in disease development in Nicotiana benthamiana. In vitro analysis validated that red fluorescence signals were consistently observed in the hyphae treated with Cy3-fluorescein-labeled dsRNA at 12, 24, 48 and 72 h postinoculation (hpi). Additionally, application of dsRNA-endoPGs, dsRNA-RPMK1 and dsRNA-PGMK (fusion of partial endoPGs and RPMK1 sequences) effectively inhibited the hyphal growth of R. solani YC-9 in vitro and suppressed disease progression in the leaves, and quantitative real-time PCR confirmed that the application of dsRNAs significantly reduced the expression levels of endoPGs and RPMK1. CONCLUSION: These results provide theoretical basis and new direction for RNAi approaches on the prevention and control of disease caused by R. solani. © 2024 Society of Chemical Industry.

Electroacupuncture pretreatment alleviates spasticity after stroke in rats by inducing the NF-κB/NLRP3 signaling pathway and the gut-brain axis.

OBJECTIVE: Spasticity is one of the most prevalent ischemic stroke sequelae and the leading cause of disability after stroke. Although electroacupuncture pretreatment has been shown to be effective in the treatment of ischemic stroke, its therapeutic effect and mechanism on post-stroke spasm remain unknown. The purpose of this study was to look into the potential mechanism of electroacupuncture pretreatment in inducing the NF-κB/NLRP3 signaling pathway and the gut-brain axis in the therapy of spasm after stroke. METHODS: After electroacupuncture treatment at Baihui (DU20) and Qubin (G87), the rat model of middle cerebral artery occlusion (MCAO) was first established. HE, Nissl, and TUNEL staining were used to detect pathological alterations in the rat brain. The relative levels of IL-4, IL-6, TNF-α, and TMAO were determined by ELISA. qRT-PCR and Western blot were used to evaluate the mRNA and protein levels of NF-κB p65, NLRP3, caspase3 and caspase9. Gas chromatography-mass spectrometry (GC-MS) was used to determine the levels of short-chain fatty acids (SCFAs) in rat gut. RESULTS: Hippocampal cells from rats with spasticity following stroke in the MCAO group were chaotic and loosely distributed with an unclear border, a blurred nucleolus, and vanished cytoplasm when compared to those from the sham operation group. Furthermore, the number of surviving neurons decreased while the number of apoptotic cells increased. In the I/R group, relative levels of IL-6, TNF-α, and TMAO increased considerably, while NF-κB p65, NLRP3, caspase3, and caspase9 were dramatically downregulated. The intestinal contents of n-propyl acetate and propyl butyrate were lowered in rats with spasticity following stroke. Electroacupuncture treatments miraculously remedied all of the foregoing pathogenic alterations. CONCLUSION: Pretreatment with electroacupuncture relieves spasticity after stroke by decreasing the inflammatory response, suppressing the NF-κB/NLRP3 signaling pathway, and modulating the gut-brain axis by increasing n-propyl acetate and propyl butyrate levels in the bowel. Our findings establish a new molecular mechanism and theoretical foundation for electroacupuncture therapy of ischemic stroke.

Bioinformatic Identification of Signaling Pathways and Hub Genes in Vascular Dementia

Background: Vascular dementia (VaD) is a prevalent neurodegenerative disease characterized by cognitive impairment due to cerebrovascular factors, affecting a significant portion of the aging population and highlighting the critical need to understand specific targets and mechanisms for effective prevention and treatment strategies. We aimed to identify pathways and crucial genes involved in the progression of VaD through bioinformatics analysis and subsequently validate these findings. Methods: We conducted differential expression analysis, Weighted Gene Co-expression Network Analysis (WGCNA), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and Protein-Protein Interaction (PPI) analysis. We utilized pheochromocytoma 12 (PC12) cells to create an in vitro oxygen-glucose deprivation (OGD) model. We investigated the impact of overexpression and interference of adrenoceptor alpha 1D (ADRA1D) on OGD PC12 cells using TdT-mediated dUTP nick-end labeling (TUNEL), reverse transcription-quantitative polymerase chain reaction (RT-qPCR), western blot (WB), and Fluo-3-pentaacetoxymethyl ester (Fluo-3 AM) analysis. Results: We found 187 differentially expressed genes (DEGs) in the red module that were strongly associated with VaD and were primarily enriched in vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction, mitogen-activated protein kinase (MAPK) signaling pathway, and cell adhesion. Among these pathways, we identified ADRA1D as a gene shared by vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction. The TUNEL assay revealed a significant decrease in PC12 cell apoptosis with ADRA1D overexpression (p < 0.01) and a significant increase in apoptosis upon silencing ADRA1D (p < 0.01). RT-qPCR and WB analysis revealed elevated ADRA1D expression (p < 0.001) ... (AU)

Whole-transcriptome characterization and functional analysis of lncRNA-miRNA-mRNA regulatory networks responsive to sugarcane mosaic virus in maize resistant and susceptible inbred lines.

Sugarcane mosaic virus (SCMV) is one of the most important pathogens causing maize dwarf mosaic disease, which seriously affects the yield and quality of maize. Currently, the molecular mechanism of non-coding RNAs (ncRNAs) responding to SCMV infection in maize is still uncovered. In this study, a total of 112 differentially expressed (DE)-long non-coding RNAs (lncRNAs), 24 DE-microRNAs (miRNAs), and 1822 DE-messenger RNAs (mRNAs), and 363 DE-lncRNAs, 230 DE-miRNAs, and 4376 DE-mRNAs were identified in maize resistant (Chang7-2) and susceptible (Mo17) inbred lines in response to SCMV infection through whole-transcriptome RNA sequencing, respectively. Moreover, 4874 mRNAs potentially targeted by 635 miRNAs were obtained by degradome sequencing. Subsequently, several crucial SCMV-responsive lncRNA-miRNA-mRNA networks were established, of which the expression levels of lncRNA10865-miR166j-3p-HDZ25/69 (class III homeodomain-leucine zipper 25/69) module, and lncRNA14234-miR394a-5p-SPL11 (squamosal promoter-binding protein-like 11) module were further verified. Additionally, silencing lncRNA10865 increased the accumulations of SCMV and miR166j-3p, while silencing lncRNA14234 decreased the accumulations of SCMV and SPL11 targeted by miR394a-5p. This study revealed the interactions of lncRNAs, miRNAs and mRNAs in maize resistant and susceptible materials, providing novel clues to reveal the mechanism of maize in resistance to SCMV from the perspective of competing endogenous RNA (ceRNA) regulatory networks.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Identification and physiological activity of (methoxymethyl)triphenylphosphonium chloride as a new phytotoxin isolated from Rhizoctonia solani AG-3 TB.

Rhizoctonia solani as a cosmopolitan fungus is the causative agent of many crop diseases and leads to significant economic losses in crop production. To explore the toxin structure and physiological activity of R. solani AG-3 TB, high-performance liquid chromatography (HPLC), infrared absorption spectrum (IR), and nuclear magnetic resonance spectrum (NMR) were required. Here, the compound (methoxymethyl)triphenylphosphonium chloride (MMC) with the molecular formula C20H20ClOP was purified and identified from R. solani AG-3 TB. The pure compound MMC treated at 20 µg/mL, 50 µg/mL, and 100 µg/mL can cause obvious necrosis on leaves, increase active oxygen species (AOS), decrease chlorophyll content, and damage cellular structure. The results enrich the understanding of toxin compounds for R. solani and provide valuable insights into the toxicology of R. solani AG-3 TB.

Particle Size Effect of Cyetpyrafen Formulation in the Pesticide Transmission Process and Its Impact on Biological Activity.

Cyetpyrafen is a compound that lacks inherent uptake and systemic translocation activity. If mites do not come into direct contact with the pesticide solution on leaves, the efficacy cannot be achieved. Controlling the particle size can potentially play a crucial role in the manifestation of efficacy. In this study, high-throughput formulation technology was used to systematically screen a large number of adjuvants to obtain cyetpyrafen formulations. The particle size of the active ingredient in the formulation was measured. By examining the dynamic light scattering and contact angle, we simulated the actual process of the efficacy transmission of cyetpyrafen formulations against Tetranychus cinnabarinus. Our results showed that the activity of cyetpyrafen increases as the particle size decreases, suggesting that reducing the particle size can enhance the coverage and deposition on crop leaves, and further improve the dispersion efficiency and enhance spreading capabilities. Furthermore, controlling the particle size at 160 nm resulted in an LC50 value of 0.2026, which is approximately double than that of the commercial product. As a novel pesticide for mites, our study presents the most effective cyetpyrafen formulation in practice. Our findings provide valuable insights into controlling other mite species that pose a threat to agricultural products.

Specific detection of Phytophthora parasitica by recombinase polymerase amplification (RPA) assays based on a unique multi-copy genomic sequence.

Phytophthora parasitica is a highly destructive oomycete plant pathogen that is capable of infecting a wide range of hosts including many agricultural cash crops, fruit trees, and ornamental garden plants. One of the most important diseases caused by P. parasitica worldwide is black shank of tobacco. Rapid, sensitive, and specific pathogen detection is crucial for early rapid diagnosis which can facilitate effective disease management. In this study, we used a genomics approach to identify repeated sequences in the genome of P. parasitica by genome sequence alignment, and identified a 203 bp P. parasitica-specific sequence, PpM34, that is present in 31-60 copies in the genome. The P. parasitica genome-specificity of PpM34 was supported by PCR amplification of 24 genetically diverse strains of P. parasitica, 32 strains representing twelve other Phytophthora species, one Pythium specie, six fungal species and three bacterial species, all of which are plant pathogens. Our PCR and real-time PCR assays showed that the PpM34 sequence was highly sensitive in specifically detecting P. parasitica. Finally, we developed a PpM34-based high-efficiency Recombinase Polymerase Amplification (RPA) assay, which allowed us to specifically detect as little as 1 pg of P. parasitica total DNA from both pure cultures and infected Nicotiana benthamiana at 39°C using a fluorometric thermal cycler. The sensitivity, specificity, convenience and rapidity of this assay represents a major improvement for early diagnosis of P. parasitica infection.

Development and validation of a machine learning model of radiation-induced hypothyroidism with clinical and dose-volume features.

BACKGROUND AND PURPOSE: Radiation-induced hypothyroidism (RIHT) is a common but underestimated late effect in head and neck cancers. However, no consensus exists regarding risk prediction or dose constraints in RIHT. We aimed to develop a machine learning model for the accurate risk prediction of RIHT based on clinical and dose-volume features and to evaluate its performance internally and externally. MATERIALS AND METHODS: We retrospectively searched two institutions for patients aged >20 years treated with definitive radiotherapy for nasopharyngeal or oropharyngeal cancer, and extracted their clinical information and dose-volume features. One was designated the developmental cohort, the other as the external validation cohort. We compared the performances of machine learning models with those of published normal tissue complication probability (NTCP) models. RESULTS: The developmental and external validation cohorts consisted of 378 and 49 patients, respectively. The estimated cumulative incidence rates of grade ≥1 hypothyroidism were 53.5% and 61.3% in the developmental and external validation cohorts, respectively. Machine learning models outperformed traditional NTCP models by having lower Brier scores at every time point and a lower integrated Brier score, while demonstrating a comparable calibration index and mean area under the curve. Even simplified machine learning models using only thyroid features performed better than did traditional NTCP algorithms. The machine learning models showed consistent performance between folds. The performance in a previously unseen external validation cohort was comparable to that of the cross-validation. CONCLUSIONS: Our model outperformed traditional NTCP models, with additional capabilities of predicting the RIHT risk at individual time points. A simplified model using only thyroid dose-volume features still outperforms traditional NTCP models and can be incorporated into future treatment planning systems for biological optimization.

Transcriptome sequencing and functional verification revealed the roles of exogenous magnesium in tobacco anti-PVY infection.

Potato virus Y (PVY) infection causes necrosis and curling of leaves, which seriously affect the yield and quality of Solanaceous crops. The roles of nutrient elements in the regulation of plant resistance to virus infection has been widely reported, while the mechanisms are poorly studied. Previous studies in our laboratory have demonstrated that foliar spraying of MgSO4 could induce Nicotiana tabacum resistance to PVY by increasing the activity of defense-related enzymes. Consistent with the results, we found that exogenous magnesium (Mg) had a certain effect on N. tabacum anti-PVY infection. Meanwhile, Illumina RNA sequencing revealed that Mg induced resistance to PVY infection was mainly by regulating carbohydrate metabolism and transportation, nitrogen metabolism, Ca2+ signal transduction and oxidative phosphorylation. Moreover, we used virus-induced gene silencing assays to verify the function of homologs of five N. tabacum genes involved in above pathways in N. benthamiana. The results showed that NbTPS and NbGBE were conducive to PVY infection, while NbPPases and NbNR were related to resistance to PVY infection. These results suggested a novel strategy for resistance to PVY infection and provided a theoretical basis for virus-resistance breeding.

Silencing SlPP2C expression delayed plant senescence and fruit ripening in tomato.

Type 2C protein phosphatases (PP2Cs) play key roles in regulating plant senescence and ripening. Here, we discovered a subfamily F PP2C, SlPP2C, associated with leaf senescence through transcriptome analysis. The gene expression, protein accumulation, and promoter activity of SlPP2C all gradually increased along with the progression of leaf and flower senescence and fruit ripening in tomato. Also, the expression of SlPP2C was highly up-regulated by the senescent-inducible hormone treatments, showing more sensitivity to ethylene (ETH) and abscisic acid (ABA). Meanwhile, SlPP2C RNA interference (RNAi) tomato transgenic lines showed obvious delayed senescence and ripening phenotypes of leaves, flowers, and fruits. SlPP2C RNAi lines delayed leaf senescence with higher chlorophyll fluorescence and content, and lower expressions of senescence marker genes (SlSGR1 and SlSAG12) compared to WT. SlPP2C RNAi lines clearly delayed flower senescence time; it was at least twice longer than WT. SlPP2C RNAi lines delayed fruit ripening, exhibiting higher firmness and lower polygalacturonase activity compared to WT. In addition, we proved that SlPP2C is unable to interact with any of the ABA receptors (SlPYLs). Together, the results demonstrate that SlPP2C is a senescence-related and ripening-related gene.

Alterations of endogenous pain-modulatory system of the cerebral cortex in the neuropathic pain.

Neuropathic pain (NeP) remains a significant clinical challenge owing to insufficient awareness of its pathological mechanisms. We elucidated the aberrant metabolism of the cerebral cortex in NeP induced by the chronic constriction injury (CCI) using metabolomics and proteomics analyses. After CCI surgery, the values of MWT and TWL markedly reduced and maintained at a low level. CCI induced the significant dysregulation of 57 metabolites and 31 proteins in the cerebral cortex. Integrative analyses showed that the differentially expressed metabolites and proteins were primarily involved in alanine, aspartate and glutamate metabolism, GABAergic synapse, and retrograde endocannabinoid signaling. Targeted metabolomics and western blot analysis confirmed the alterations of some key metabolites and proteins in endogenous pain-modulatory system. In conclusion, our study revealed the alterations of endocannabinoids system and purinergic system in the CCI group, and provided a novel perspective on the roles of endogenous pain-modulatory system in the pathological mechanisms of NeP.